View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1727_high_12 (Length: 260)
Name: NF1727_high_12
Description: NF1727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1727_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 2624131 - 2623886
Alignment:
| Q |
1 |
ctatttgtgaggcctattttgggatcaggtacccttgtgtaaacactctcatccacgttcccttcactctctccatgtctaacaagaattattcttctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624131 |
ctatttgtgaggcctattttgggatcaggtacccttgtgtaaacactctcatccacgttcccttcactctctccatgtctaacaagaattattcttctag |
2624032 |
T |
 |
| Q |
101 |
gccttggaggcactgcaccaactttggaggctagtaaagggtttatcagaggatttttctctggaaacctggtatgtccattgttgttggttagtgaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2624031 |
gccttggaggcactgcaccaactttggaggctagtaaagggtttatcagaggatttttctctggaaacctggtatgtccattgttgttggttagtgaatc |
2623932 |
T |
 |
| Q |
201 |
tatagggtctgtttggctgtgacaacattggattagtaagtatgtg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2623931 |
tatagggtctgtttggctgtgacaacattggattagtaagtatgtg |
2623886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University