View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1727_high_14 (Length: 240)
Name: NF1727_high_14
Description: NF1727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1727_high_14 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 47742 - 47863
Alignment:
| Q |
18 |
cctgcaatatttcttcatcctcgcattaggaaggccatttggcatggtagcacaaactcaaaaactgataaaggtatactcatatgatgttgtctaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47742 |
cctgcaatatttcttcatcctcgcattaggaaggccatttggcatggtagcacagactcaataactgataaaggtatactcatatgatgttgtctaattt |
47841 |
T |
 |
| Q |
118 |
cgtggtgtttttacacccattt |
139 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47842 |
cgtggtgtttttacacccattt |
47863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University