View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1727_high_17 (Length: 235)
Name: NF1727_high_17
Description: NF1727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1727_high_17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40826122 - 40825888
Alignment:
| Q |
1 |
tcccatgtactgcaaccagattgacatgctgctgcttttgaactgcttgccacaactttatacagcatcacattatatcaaggacaactcaaaatatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40826122 |
tcccatgtactgcaaccagattgacatgctgctgcttttgaactgcttgccacaactttatacagcatcacattataccaaggacaactcaaaatatttt |
40826023 |
T |
|
| Q |
101 |
ggttacatcacaagcaagagatttactcaattcaatcatagcccagctaaaactcatagacatagctatannnnnnnatacacatcccaccgtcc-tttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
40826022 |
ggttacatcacaagcaagagatttactcaattcaatcatagcccagct-aaactcatagacatagctatatttttttatacacatcccaccgtccttttt |
40825924 |
T |
|
| Q |
200 |
tcatttttattcaaaatagaataaaattataaaaag |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40825923 |
tcatttttattcaaaatagaataaaattataaaaag |
40825888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University