View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1727_low_14 (Length: 246)
Name: NF1727_low_14
Description: NF1727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1727_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 305072 - 305297
Alignment:
| Q |
18 |
gtttagctctaggatctagttttgttatacggttag-------tatatgtgatgcaaaagataaacaaccaaagtggcatgtcataaagcaattcaaaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
305072 |
gtttagctctaggatctagttttgttatacggttaagtatatctatatgtgatgcaaaagataaacaaccaaagtggcatgtcataaagcaattcaaaag |
305171 |
T |
 |
| Q |
111 |
gagttttgtgtggttaccctgtttataataacggtggtatggcgggggaattaggaagtttagaatggaacagtaaagttttagtaacattttatttatg |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
305172 |
gagttttgtgtggttaacctgtttataataacggtggtatggcgggggaattaggaagtttagaatggaacagtaaagttttagtaacattttatttatg |
305271 |
T |
 |
| Q |
211 |
gcttaattgtacttttgatccctatg |
236 |
Q |
| |
|
||||||||| | ||||| |||||||| |
|
|
| T |
305272 |
gcttaattgcatttttggtccctatg |
305297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University