View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1727_low_17 (Length: 239)
Name: NF1727_low_17
Description: NF1727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1727_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 40825745 - 40825523
Alignment:
| Q |
1 |
tcaaatgttatagtattactgtattaagcactatatacagtgccagaaagttgtgagaacaaagatgcaggtattatatatatcactaattacaaagaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40825745 |
tcaaatgttatagtattactgtattaagcactatatacagtgccaaaaagttgtgagaacaaagatgcaggtattatatatatcactaattacaaaaaag |
40825646 |
T |
 |
| Q |
101 |
ggtggactctaaact----taagccacccagcatatcttcctagatccctgcctaccgacgaagattaatttatttggtaattcaattaattaatattta |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40825645 |
ggtggactctaaacttaagtaagccacccagcatatcttcctagatccctgcctaccgacgaagattaattaatttggtaattcaattaattaatattta |
40825546 |
T |
 |
| Q |
197 |
taaagtttactttatggtgtcac |
219 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40825545 |
taaagtttactttatggtgtcac |
40825523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University