View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1727_low_19 (Length: 213)
Name: NF1727_low_19
Description: NF1727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1727_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 36332069 - 36331894
Alignment:
| Q |
20 |
gaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgattg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36332069 |
gaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgattg |
36331970 |
T |
|
| Q |
120 |
ctgcaattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331969 |
ctgcaattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtat |
36331894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 36324808 - 36324633
Alignment:
| Q |
20 |
gaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattgtctctagctacattttttcttttcacttctatgattg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36324808 |
gaaagccaaaatatactcaaaggtaatggttgaactcctggaacagcatcaagcatgttattatctctagctacattttttcttttcacttctatgattg |
36324709 |
T |
|
| Q |
120 |
ctgcaattgccatcgagatgcaggatagtattaggccgacacctatgcgctgcaggtgcgtgactccggttggtat |
195 |
Q |
| |
|
| || |||||||||||||||||||||||||||||||| || ||||| ||||||| ||| || | ||||||||||| |
|
|
| T |
36324708 |
ccgcgattgccatcgagatgcaggatagtattaggccaacgcctattcgctgcaagtgagtaatgccggttggtat |
36324633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University