View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17281_high_6 (Length: 343)
Name: NF17281_high_6
Description: NF17281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17281_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 18 - 333
Target Start/End: Original strand, 39924345 - 39924659
Alignment:
| Q |
18 |
cttggtgctctcgcaaactcctcaacatgttgtatcagagtcatgttttgacttagtggaggagcgggagtgaatcatgatgtttagaccaattataaga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
39924345 |
cttggtgctctcgcaaactcctcaacatgttgtatcagagtcatgttttgacttagtcgaggagcgtgagtgaatcatggtgtttagatcaattataaga |
39924444 |
T |
|
| Q |
118 |
tgccgacgactcgcgtttaagagaaaatttgttggattttcatgtgaatcgttaagtcacacgtcaactttgagattgtaaaatatgaacaataaaagga |
217 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39924445 |
tgccgacgacttgcgtttaagagaaaatttgttggattttcatgtgaatggttaagtcacacgacaattttgagattgtaaaatatgaacaataaaagga |
39924544 |
T |
|
| Q |
218 |
tatgactcgtatatcttataatattttaagattttggatggagatgtgggatatcttcttttcttatggtctttgaagcgttgttgctacgggcaaactc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39924545 |
tatgactcgtatatcttataatattttaagattttggatgaagatgtgggatatcttcttctcttatggtc-ttgaagcgttgttgctacgggcaaactc |
39924643 |
T |
|
| Q |
318 |
ccccaccacaggttct |
333 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
39924644 |
ccccaccacatgttct |
39924659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University