View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17281_high_8 (Length: 314)
Name: NF17281_high_8
Description: NF17281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17281_high_8 |
 | |
|
| [»] scaffold0317 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 309
Target Start/End: Complemental strand, 54425451 - 54425164
Alignment:
| Q |
12 |
acagagtgaagagatggttcttccttgaaggcgttgaaccatgatttgcaaacaagcatcgcaccacgccattgatcgtcaaagctgagtcgagatagga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
54425451 |
acagagtgaagagatggttcttccttgaaggcgttgaaccatgatttgcaaacaagcaacgaaccgcgccattgatcttcaaagctgagtcgagatagga |
54425352 |
T |
|
| Q |
112 |
tattgatgaggcactcacgagtcaactcgccccactcggcttcgctttcttcttccatttttgttccttctattgtttggatttagacggaactgcgtcc |
211 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54425351 |
tgttgatgaggcactcacgagtcaactcgccccactcggcttcgctttctacttccatttttgttccttctattgtttggatttagacggaactgcgtcc |
54425252 |
T |
|
| Q |
212 |
ctagtaatagatagatcatttttagactccaatccaacacgtgcgatgcacgg--gtttttgtagagtttcatatataactataaaatatcaaattggtc |
309 |
Q |
| |
|
| |||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
54425251 |
attgtaatagata----atttttagac-----tccaacacgtgcgatgcacggttttttttgtagagtttcatat---agtataaaatatcaaattggtc |
54425164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 14 - 145
Target Start/End: Original strand, 54430299 - 54430430
Alignment:
| Q |
14 |
agagtgaagagatggttcttccttgaaggcgttgaaccatgatttgcaaacaagcatcgcaccacgccattgatcgtcaaagctgagtcgagataggata |
113 |
Q |
| |
|
|||||||||||| ||||||||||| ||||| ||||||||||||| || |||||||| ||||| ||||||||||| |||| | |||||||| | ||| |
|
|
| T |
54430299 |
agagtgaagagaaggttcttccttaaaggcactgaaccatgatttacatacaagcattgcaccgcgccattgatcttcaacggtgagtcgaatgaagatg |
54430398 |
T |
|
| Q |
114 |
ttgatgaggcactcacgagtcaactcgcccca |
145 |
Q |
| |
|
||||||||||| || |||| ||||||||||| |
|
|
| T |
54430399 |
ttgatgaggcaatctcgagataactcgcccca |
54430430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0317 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0317
Description:
Target: scaffold0317; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 247 - 292
Target Start/End: Original strand, 19789 - 19833
Alignment:
| Q |
247 |
aacacgtgcgatgcacgggtttttgtagagtttcatatataactat |
292 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
19789 |
aacacgtgcgatgcacaggtttt-gtagagtttcatatataactat |
19833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 251 - 288
Target Start/End: Complemental strand, 37381911 - 37381874
Alignment:
| Q |
251 |
cgtgcgatgcacgggtttttgtagagtttcatatataa |
288 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37381911 |
cgtgcgatgcacgtgtttttgtagagtttcatatataa |
37381874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 251 - 288
Target Start/End: Original strand, 30694356 - 30694392
Alignment:
| Q |
251 |
cgtgcgatgcacgggtttttgtagagtttcatatataa |
288 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30694356 |
cgtgcgatgcacgggtttt-gtagagtttcatatataa |
30694392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University