View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17281_low_10 (Length: 304)
Name: NF17281_low_10
Description: NF17281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17281_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-147; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 31225353 - 31225635
Alignment:
| Q |
1 |
tgttgtcgtggcggtgggctttggttagaattaatattcccc-gtgtatgtacttcaaatggtgttggaacccaagggagtgtcttttgcgaatggctta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31225353 |
tgttgtcgtggcggtgggctttggttagaattaatattcccccgtgtatgtacttcaaatggttttggaacccaagggagtgtcttttgcgaatggctta |
31225452 |
T |
|
| Q |
100 |
agctgatccggtgctgttatgtgttgggtgatgcggtgttctgcagtttttctggtgtcgggtttctgtcggttgttggtgttcgctgctgagtttttgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31225453 |
agctgatccggtgctgttatgtgttgggtgatgcggtgttctgcagtttttttggtgtcgggtttctgtcggttgttggtgttcgctgctgagtttttgg |
31225552 |
T |
|
| Q |
200 |
gggctattttgtgggttcaaacaacacttgttgttttttcctgtgcagctgctgtgttgcattagcaaggcctgttgtgttgg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31225553 |
gggctattttgtgggttcaaacaacacttgctgttttttcctgtgcagctgctgtgttgcattagcaaggcctgttgtgttgg |
31225635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 41 - 90
Target Start/End: Original strand, 35400865 - 35400914
Alignment:
| Q |
41 |
ccgtgtatgtacttcaaatggtgttggaacccaagggagtgtcttttgcg |
90 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||||||||| ||||||| |
|
|
| T |
35400865 |
ccgtgtatgtattacgaatggtgttggaacccaagggagtgtattttgcg |
35400914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 97 - 237
Target Start/End: Complemental strand, 41310408 - 41310269
Alignment:
| Q |
97 |
ttaagctgatccggtgctgttatgtgttgggtgatgcggtgttctgcagtttttctggtgtcgggtttctgtcggttgttggtgttcgctgctgagtttt |
196 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| |||||||| ||||||||| | || || ||| ||||||| ||| ||| ||||| |||||||||||| |
|
|
| T |
41310408 |
ttaagttgctccggtgctgtcctgtgttgggtgctgcggtgtactgcagtttctttgctgccggtattctgtcagtt-ttgctgttctctgctgagtttt |
41310310 |
T |
|
| Q |
197 |
tgggggctattttgtgggttcaaacaacacttgttgttttt |
237 |
Q |
| |
|
|||||||| |||| ||||||||||| ||| || ||||||| |
|
|
| T |
41310309 |
tgggggctcctttgcgggttcaaacagcacctgctgttttt |
41310269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University