View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17282_high_21 (Length: 304)
Name: NF17282_high_21
Description: NF17282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17282_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 236 - 289
Target Start/End: Complemental strand, 52206336 - 52206283
Alignment:
| Q |
236 |
attttgagatctatggcttagaagaacataataacacaaatggaggtgatattt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52206336 |
attttgagatctatggcttagaagaacataataacacaaatggaagtgatattt |
52206283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University