View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17282_low_16 (Length: 360)
Name: NF17282_low_16
Description: NF17282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17282_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 46913702 - 46913384
Alignment:
| Q |
18 |
tgtaggattaagagcaagatagcataagagaagttcatgaagataatcccaatcattagtaacatcaaccacttgttgttgagattgaatcatttcctgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46913702 |
tgtaggattaagagcaagatagcataagagaagttcatgaagataatcccaatcgttagtaacatccaccacttgttgttgagattgaatcatttcctgc |
46913603 |
T |
|
| Q |
118 |
atagaacggaggaaatcaacgtaagggtttacagaatattttggcaccctcttcacactacctcctcttggtatcaacgagttattacagggtagagtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913602 |
atagaacggaggaaatcaacgtaagggtttacagaatattttggcaccctcttcacactacctcctcttggtatcaacgagttattacagggtagagtgt |
46913503 |
T |
|
| Q |
218 |
cgttggagggagactctgtgatggaattggagctgcctggggaggagaagaagaaccgttgggaggcgaagacggaagaaaagtcaggtggtggaagctc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913502 |
cgttggagggagactctgtgatggaattggagctgcctggggaggagaagaagaaccgttgggaggcgaagacggaagaaaagtcaggtggtggaagctc |
46913403 |
T |
|
| Q |
318 |
cgtggtgtcgtagaaatag |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
46913402 |
cgtggtgtcgtagaaatag |
46913384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University