View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17282_low_20 (Length: 314)
Name: NF17282_low_20
Description: NF17282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17282_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 152 - 306
Target Start/End: Complemental strand, 14766657 - 14766505
Alignment:
| Q |
152 |
catgcattccttattatcataacttcgttaaagatgatatactcttcctcctgaaaaattatcatctatgtgaaatttttaagtaagaaagaatgttaaa |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14766657 |
catgcattccgtattatcataacttcgttaaagatgatatactct-cctcctgaaaaat-atcatctatgtgaaatttttaagtaagaaagaatgttaaa |
14766560 |
T |
|
| Q |
252 |
actatttataaaaaatgttgacactaatgtgcaaacaaatatggtaaagaataat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
14766559 |
actatttataaaaaatgttgacactaatgtgcaaataaataaggtaaagaataat |
14766505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 14766805 - 14766719
Alignment:
| Q |
1 |
atggtcaattttagtataatatagtgtgcaagtctttcagaaatgagaaacatgtcattgttacttccatcatatactgtattatcg |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
14766805 |
atggtcaattttagtataatatagtgtgcaagtctttcagaaatgagaaacatgtcattgctacttccatcatatagtgtcttatcg |
14766719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University