View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17282_low_22 (Length: 294)
Name: NF17282_low_22
Description: NF17282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17282_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 52890142 - 52889856
Alignment:
| Q |
1 |
ctaacttgatatctgattttcttagagatgagccgtgtacgacgcttttctttgtaacgcagcaccctggcttctcttacaccacttcctcctccattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52890142 |
ctaacttgatatctgattttcttagagatgaggcgtgtacgacgcttttctttgtaacgcatcacgctggcttctcttacaccacttcctcctccattct |
52890043 |
T |
|
| Q |
101 |
cccataacaaatctatttgtgacaaccgtgcctgtctcccacaatatcaataaatta--------ttcacacactatctattaaataaatgtgtcacgac |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52890042 |
cccataacaaatctatttgtgacaaccgtgcctgtctcccacaatatcaattaattattcataccttcacacactatctattaaataaatgtgtcacgac |
52889943 |
T |
|
| Q |
193 |
aatgatattatttatttatttggcatttcaaataatggcacaacgtcacctaaattataaca----tatgctactagaaactagaaagtgagaa |
282 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52889942 |
tatgatattatttattt-------atttcaaataatgccacaacgtcacctaaattataacatacttatgctactagaaactagaaagtgagaa |
52889856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University