View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17282_low_25 (Length: 273)
Name: NF17282_low_25
Description: NF17282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17282_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 23 - 261
Target Start/End: Original strand, 51507721 - 51507959
Alignment:
| Q |
23 |
gagccgtacgggtacatcaatataaaattagtttttaatcataatataacatgatagaattatattgttcaaatggcaaccaaaatcaaaaatctatttg |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
51507721 |
gagctgtacgggtacatcaatataaaattagtttttaatcataatataacatgatagaattatattgttcaaatggaaaccaaaatcaaaaacctatttg |
51507820 |
T |
 |
| Q |
123 |
ttcaaaaaactcaagatctatatgcatgactattaaaaatcacactctgacactgtcaataacaatatcactatatctttttccgcaagtaaaagttcaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51507821 |
ttcaaaaaactcaagatctatatgcatgactattaaaaatcacactctgacactgtcaataacaatatcactatatctttttccccaagtaaaagttcaa |
51507920 |
T |
 |
| Q |
223 |
gttttaaataaatggctgcttacttcaagttccgagtat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51507921 |
gttttaaataaatggctgcttacttcaagttccgagtat |
51507959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University