View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17283_high_14 (Length: 228)
Name: NF17283_high_14
Description: NF17283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17283_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 11811550 - 11811747
Alignment:
| Q |
18 |
attttagcttcggaggtaatcaatttattgccgaagaatcgattctttggtaatgtgtctgtgaagtttgatattcggaaggcttttgataccatggatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
11811550 |
attttagcttcggaggtaatcaatttattgccgaagaaacgactttttggtaatgtgtctgtgaaggttgatattcggaaggcttttgataccatgggtt |
11811649 |
T |
|
| Q |
118 |
ggaattttcttttgttggttttaaaaacttttggcttccatccagttttctgtgattggattcgtgcgattttgcactctgctcgcttgtctgtgctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11811650 |
ggaattttcttttgttggttttaaaaacttttggcttccatccagttttctgtgattggattcgtgcgattttgcactctgctcgcttgtcagtgctg |
11811747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 85 - 137
Target Start/End: Original strand, 20493970 - 20494022
Alignment:
| Q |
85 |
ttgatattcggaaggcttttgataccatggattggaattttcttttgttggtt |
137 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
20493970 |
ttgatattcagaaggcttttgatacaatggattggaattttcttcttttggtt |
20494022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 137
Target Start/End: Complemental strand, 26786682 - 26786630
Alignment:
| Q |
85 |
ttgatattcggaaggcttttgataccatggattggaattttcttttgttggtt |
137 |
Q |
| |
|
|||||||||| || |||||||| ||||| |||||||||||| | ||||||||| |
|
|
| T |
26786682 |
ttgatattcgaaaagcttttgacaccattgattggaattttttgttgttggtt |
26786630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University