View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17283_low_11 (Length: 303)
Name: NF17283_low_11
Description: NF17283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17283_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 95 - 289
Target Start/End: Original strand, 26218229 - 26218423
Alignment:
| Q |
95 |
cattaatcacaaaaattagtgttgcgtaaaatttacagcgttttacatattttacccggtatcaaaacatgttctaatattgtaaactttatcagtgatt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26218229 |
cattaatcacaaaaattagtgttgcgtaaaatttacagcgttttacatattttacccggtatcaaaacatgttctaatattgtaaactttatcagtgatt |
26218328 |
T |
|
| Q |
195 |
cactgttgccagcaacgacattagccaccgacaccaccacctactagcagtgattcattcctggagcggttgtatatttttcagcaggtgtttat |
289 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26218329 |
cactgctgccagcaacgacattagccaccgacaccaccacctactagcagtgattcattcctggagcggttgtatatttttcagcaggtgtttat |
26218423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University