View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17283_low_12 (Length: 256)
Name: NF17283_low_12
Description: NF17283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17283_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 148 - 231
Target Start/End: Original strand, 37997471 - 37997559
Alignment:
| Q |
148 |
atgttacaaaataattgcattttatttc-tatgtcttggtcacactctgta----attgtacaaatgtcattcttgcaagatcatttct |
231 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||| ||| ||||| |||| |||||||||| || |||||||||||||||||||| |
|
|
| T |
37997471 |
atgttacaaaataattgccttttatttcatatgtctaggttacactttgtacataattgtacaaaggtaattcttgcaagatcatttct |
37997559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 52 - 175
Target Start/End: Complemental strand, 24975570 - 24975450
Alignment:
| Q |
52 |
tattttgccctccattttttgccacctctttccaatttcgcactcccacatctcttatgcatctatgtgacatactagttggcatgcattgtca--ctat |
149 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||||| ||||||||||||||||| || ||||| | || |||||||||||||||| || |
|
|
| T |
24975570 |
tattttgtcctccattttttgtcacatctttccaatttcatcctcccacatctcttatgtatttatgtta-----taattggcatgcattgtcattgtac |
24975476 |
T |
 |
| Q |
150 |
gttacaaaataattgcattttatttc |
175 |
Q |
| |
|
|||||||||||||||| | ||||||| |
|
|
| T |
24975475 |
gttacaaaataattgcctattatttc |
24975450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 53 - 102
Target Start/End: Original strand, 37996846 - 37996895
Alignment:
| Q |
53 |
attttgccctccattttttgccacctctttccaatttcgcactcccacat |
102 |
Q |
| |
|
||||||||||| |||||| ||||||||||| ||||||||| |||| |||| |
|
|
| T |
37996846 |
attttgccctctatttttggccacctcttttcaatttcgccctcctacat |
37996895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 35 - 70
Target Start/End: Original strand, 25421897 - 25421932
Alignment:
| Q |
35 |
taattgcctaaaatgactattttgccctccattttt |
70 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25421897 |
taattgcttaaaatgactattttgccctccattttt |
25421932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University