View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17283_low_13 (Length: 245)
Name: NF17283_low_13
Description: NF17283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17283_low_13 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 12683140 - 12682914
Alignment:
| Q |
19 |
tcatactctcaccattgttatcacttttcgcaacttccatattcgtcacttgctgctgttgtacctgaacctgctgttgctgctgctgatgttgtggcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12683140 |
tcatactctcaccattgttatcacttttcgcaacttccatattcatcacttgctgctgttgtacctgaacctgctgttgctgctgctgatgttgtggcaa |
12683041 |
T |
|
| Q |
119 |
tggtgaagcctgaggaatgactgatgtttgttgttgcactgttacagttggattttgaacttgctgcggtgtaggtattgctggtatcggtatcggcaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
12683040 |
cggtgaagcctgaggaatgactgatgtttgttgttgcactgttacagttggattttgaacttgctgcggtgtaggtattgctggtatcggtattggcaat |
12682941 |
T |
|
| Q |
219 |
ggtgctgctgctgctggcaacggtact |
245 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
12682940 |
ggtgctgctgctgctggcaacggtact |
12682914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University