View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17283_low_16 (Length: 228)

Name: NF17283_low_16
Description: NF17283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17283_low_16
NF17283_low_16
[»] chr4 (1 HSPs)
chr4 (18-215)||(11811550-11811747)
[»] chr5 (2 HSPs)
chr5 (85-137)||(20493970-20494022)
chr5 (85-137)||(26786630-26786682)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 18 - 215
Target Start/End: Original strand, 11811550 - 11811747
Alignment:
18 attttagcttcggaggtaatcaatttattgccgaagaatcgattctttggtaatgtgtctgtgaagtttgatattcggaaggcttttgataccatggatt 117  Q
    |||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||| ||    
11811550 attttagcttcggaggtaatcaatttattgccgaagaaacgactttttggtaatgtgtctgtgaaggttgatattcggaaggcttttgataccatgggtt 11811649  T
118 ggaattttcttttgttggttttaaaaacttttggcttccatccagttttctgtgattggattcgtgcgattttgcactctgctcgcttgtctgtgctg 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
11811650 ggaattttcttttgttggttttaaaaacttttggcttccatccagttttctgtgattggattcgtgcgattttgcactctgctcgcttgtcagtgctg 11811747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 85 - 137
Target Start/End: Original strand, 20493970 - 20494022
Alignment:
85 ttgatattcggaaggcttttgataccatggattggaattttcttttgttggtt 137  Q
    ||||||||| ||||||||||||||| |||||||||||||||||| | ||||||    
20493970 ttgatattcagaaggcttttgatacaatggattggaattttcttcttttggtt 20494022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 137
Target Start/End: Complemental strand, 26786682 - 26786630
Alignment:
85 ttgatattcggaaggcttttgataccatggattggaattttcttttgttggtt 137  Q
    |||||||||| || |||||||| ||||| |||||||||||| | |||||||||    
26786682 ttgatattcgaaaagcttttgacaccattgattggaattttttgttgttggtt 26786630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University