View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17283_low_17 (Length: 214)
Name: NF17283_low_17
Description: NF17283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17283_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 5 - 201
Target Start/End: Original strand, 43560804 - 43561003
Alignment:
| Q |
5 |
tctgaaacttcttccactttcatcaactctaaaagaattgagttgtatatcagtttacttacacttatatgcctttgttctagaa---gtttaaaccatc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43560804 |
tctgaaacttcttccactttcatcaactctaaaaaaattgagttgtatatcagtttacttacacttatatgcctttgttctagaattagtttaaaccatc |
43560903 |
T |
 |
| Q |
102 |
ctttactagaatttataaaattaagtctctaataaataaattctctttcatctctactgttcccaatactgagtttggagaacttgtatctcaatgttga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43560904 |
ctttactagaatttataaaattaagtctctaataaataaatgctctttcatttctactgttcccaatactgagtttggagaacttgtatctcaatgttga |
43561003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University