View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17285_low_27 (Length: 223)
Name: NF17285_low_27
Description: NF17285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17285_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 62 - 187
Target Start/End: Complemental strand, 7589610 - 7589485
Alignment:
| Q |
62 |
aatcttcctttaaaaatggtcgaagttggggaggtgttgcaagtctaaaaataaattgagagagatggaaaacttagcaagtaaatacgatggtatattg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7589610 |
aatcttcctttaaaaatggtcgaagttggggaggtgttgcaagtctaaaaataaattgagagagatggaaaacttagcaagtaaatacgatggtatattg |
7589511 |
T |
 |
| Q |
162 |
cagagtgggaatttgaccaaggttcg |
187 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7589510 |
cagagtgggaatttgaccaaggttcg |
7589485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 45
Target Start/End: Complemental strand, 7589669 - 7589631
Alignment:
| Q |
7 |
gaggttgcacatttgcaacacacaacccccacttccagt |
45 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7589669 |
gaggttgcacatttgcaacgcacaacccccacttccagt |
7589631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University