View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17285_low_31 (Length: 207)
Name: NF17285_low_31
Description: NF17285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17285_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 15 - 95
Target Start/End: Original strand, 14937344 - 14937424
Alignment:
| Q |
15 |
cagagaaaaacgaacgacctaagaggttggtggtttgcgggactgtggaaaatgttaacgatcttatgcggcggaatcagt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14937344 |
cagagaaaaacgaacgacctaagaggttggtggtttgcgggactgtggaaaatgttaacgatcttatgcggcggaatcagt |
14937424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University