View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17286_low_2 (Length: 314)
Name: NF17286_low_2
Description: NF17286
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17286_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 14549209 - 14548908
Alignment:
| Q |
1 |
tcccagatggctctagacgcatgtacatcgtcgtgaacgtgaaaccgaacacaatatacatgtcatgtgtgcagcctccaataaaggtttgtctttttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
14549209 |
tcccagatggctctagacgcatgtacatcgtcgtgaacgtgaaaccgaacacaatatacatgtcatgtgtgcagcctccaataaaggcttgtcttcttct |
14549110 |
T |
 |
| Q |
101 |
aactcatcagctacaccctcacctatatggatcattgactttggagcctcccaatcacatacatcttgtctaattttaaatcttttgtatctttacatcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14549109 |
aactcatcagctacaccctcacctatatggatcattgactttggagcctcccaatcacatacatcttgtctaattttaaatcttttgtatctttacatcc |
14549010 |
T |
 |
| Q |
201 |
cacttcatctgtgccagccatgattgctgatgacactcttgctcaaactttgccttttccaagaataacattatactattatcttgttaccccttcatct |
300 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
14549009 |
catttcatctgtgccagccatgattgctgatgacactcttgctcaaactttactttttccaagaataacattatac---tatcttgttaccccttcttgt |
14548913 |
T |
 |
| Q |
301 |
cactc |
305 |
Q |
| |
|
||||| |
|
|
| T |
14548912 |
cactc |
14548908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University