View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_20 (Length: 431)
Name: NF17287_high_20
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 388; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 17 - 416
Target Start/End: Original strand, 12304313 - 12304712
Alignment:
| Q |
17 |
ctgtggagcgtcaaaaacttggtatggtatccctggtcacgcagctttggaatttgaaagggtggtgagagaacaagtgtattctactgatattttgtca |
116 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12304313 |
ctgtggagcatcaaaaacttggtatggtatccctggtcacgcagctttggaatttgaaagggtggtgagagaacatgtgtattctactgatattttgtca |
12304412 |
T |
 |
| Q |
117 |
agtgatggagaagatggagcctttgatgttctcttggggaaaacaactttatttccacctaatattttgatggagcataaagtccctgtctataaggctg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12304413 |
agtgatggagaagatggagcctttgatgttctcttggggaaaacaactttatttccacctaatattttgatggagcataaagtccctgtctataaggctg |
12304512 |
T |
 |
| Q |
217 |
ttcaaaagccaggggagtttgtaataaccttccctagagcgtatcatgcaggcttcagtcatggttagatttgctcttttcaattgttttgttctagtaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12304513 |
ttcaaaagccaggggagtttgtaataaccttccctagagcgtatcatgcaggcttcagtcatggttagattttctcttttcaattgttttgttctagtaa |
12304612 |
T |
 |
| Q |
317 |
ttacatcttttcccgatactacacattaaatgcatgtgaaatattaatgttgtgtatcttcaataaataggtttcaactgtggagaagcagtgaattttg |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12304613 |
ttacatcttttcccgatactacacattaaatgcatgtgaaatattaatgttgtgtatcttcaataaataggtttcaactgtggagaagcagtgaattttg |
12304712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University