View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_37 (Length: 359)
Name: NF17287_high_37
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 1e-78; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 141 - 351
Target Start/End: Complemental strand, 55759326 - 55759098
Alignment:
| Q |
141 |
acgaatttgatttttcacaagtgttcttgttgattgagttttcaccacgttaattgattaatcatgaactttattcatcttaannnnnnnagtctaggtc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55759326 |
acgaatttgatttttcacaagtgttcttgttgattgagttttcaccacgttaattgattaatcatgaactttattcatcttaatttttttagtctaggtc |
55759227 |
T |
 |
| Q |
241 |
ataatttgattattttcttcactaaccttttgtttagattgttgatatttagtacttgattgttta------------------gctgttttgattgatt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55759226 |
ataatttgattattttcttcactaaccttttgtttagattgttgatatttagtacttgattgtttagatttactgattattgatgctgttttgattgatt |
55759127 |
T |
 |
| Q |
323 |
tttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
55759126 |
tttcaccataatctttgagtataatctac |
55759098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 55757754 - 55757710
Alignment:
| Q |
307 |
gctgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55757754 |
gctgttttgattgatttttcaccataatctttgagtataatctac |
55757710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 55758102 - 55758058
Alignment:
| Q |
307 |
gctgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55758102 |
gctgttttgattgatttttcaccataatctttgagtataatctac |
55758058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 307 - 351
Target Start/End: Complemental strand, 55758794 - 55758750
Alignment:
| Q |
307 |
gctgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55758794 |
gctgttttgattgatttttcaccataatctttgagtataatctac |
55758750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 309 - 351
Target Start/End: Complemental strand, 55757926 - 55757884
Alignment:
| Q |
309 |
tgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55757926 |
tgttttgattgatttttcaccataatctttgagtataatctac |
55757884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 309 - 351
Target Start/End: Complemental strand, 55758274 - 55758232
Alignment:
| Q |
309 |
tgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55758274 |
tgttttgattgatttttcaccataatctttgagtataatctac |
55758232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 309 - 351
Target Start/End: Complemental strand, 55758448 - 55758406
Alignment:
| Q |
309 |
tgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55758448 |
tgttttgattgatttttcaccataatctttgagtataatctac |
55758406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 309 - 351
Target Start/End: Complemental strand, 55758622 - 55758580
Alignment:
| Q |
309 |
tgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55758622 |
tgttttgattgatttttcaccataatctttgagtataatctac |
55758580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 309 - 351
Target Start/End: Complemental strand, 55758966 - 55758924
Alignment:
| Q |
309 |
tgttttgattgatttttcaccataatctttgagtataatctac |
351 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55758966 |
tgttttgattgatttttcaccatactctttgagtataatctac |
55758924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 42 - 75
Target Start/End: Complemental strand, 55759425 - 55759392
Alignment:
| Q |
42 |
gaattgttcactgatgaatctattgtgttatgaa |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55759425 |
gaattgttcactgatgaatctattgtgttatgaa |
55759392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 276 - 307
Target Start/End: Complemental strand, 55757803 - 55757772
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55757803 |
agattgttgatatttagtacttgattgtttag |
55757772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 276 - 307
Target Start/End: Complemental strand, 55757977 - 55757946
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55757977 |
agattgttgatatttagtacttgattgtttag |
55757946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 276 - 307
Target Start/End: Complemental strand, 55758151 - 55758120
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55758151 |
agattgttgatatttagtacttgattgtttag |
55758120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 276 - 307
Target Start/End: Complemental strand, 55758325 - 55758294
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55758325 |
agattgttgatatttagtacttgattgtttag |
55758294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 276 - 307
Target Start/End: Complemental strand, 55758499 - 55758468
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55758499 |
agattgttgatatttagtacttgattgtttag |
55758468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 276 - 307
Target Start/End: Complemental strand, 55758843 - 55758812
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55758843 |
agattgttgatatttagtacttgattgtttag |
55758812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 276 - 307
Target Start/End: Complemental strand, 55759017 - 55758986
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55759017 |
agattgttgatatttagtacttgattgtttag |
55758986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 305
Target Start/End: Complemental strand, 55757629 - 55757600
Alignment:
| Q |
276 |
agattgttgatatttagtacttgattgttt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55757629 |
agattgttgatatttagtacttgattgttt |
55757600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 237 - 307
Target Start/End: Original strand, 38940705 - 38940779
Alignment:
| Q |
237 |
ggtcataatttgattattttcttcact---aaccttttgttta-gattgttgatatttagtacttgattgtttag |
307 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
38940705 |
ggtcatcatttgattattttcttcactcataaccttttgtttaagattgttgatatctagtacttgattgtttag |
38940779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 300
Target Start/End: Original strand, 38940552 - 38940621
Alignment:
| Q |
235 |
taggtcataatttgattattttcttcact---aaccttttgttta-gattgttgatatttagtacttgat |
300 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38940552 |
taggtcattatttgattatttttttcactcataaccttttgtttaagattgttgatatttagtacttgat |
38940621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 38940438 - 38940478
Alignment:
| Q |
144 |
aatttgatttttcacaagtgttcttgttgattgagttttca |
184 |
Q |
| |
|
||||| ||||||| |||||||||||||| |||||||||||| |
|
|
| T |
38940438 |
aattttatttttctcaagtgttcttgtttattgagttttca |
38940478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 350
Target Start/End: Original strand, 38940623 - 38940659
Alignment:
| Q |
314 |
tgattgatttttcaccataatctttgagtataatcta |
350 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
38940623 |
tgattaatttttcaccatgatctttgagtataatcta |
38940659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University