View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_50 (Length: 286)
Name: NF17287_high_50
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 28887680 - 28887948
Alignment:
| Q |
1 |
tcatcattttgatgatactatataaggaacaagcttgtaagaaataggtgctaatacaacaaatttagattcatcaatcacctcctaagtgttacgtaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28887680 |
tcatcattttgatgatactatataaggaacaagcttgtaagaaataggtgctaatacaacaaatttagattcatcaatcacctcctaagtgttacataat |
28887779 |
T |
|
| Q |
101 |
gggaacagaagccataaggtactttttgttttgtttaggtggtctttgtatacaaaaaatagcaaatactttgtaacaacatagttgatttttagtttta |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28887780 |
ggggacagaagccataaggtactttttgttttgtttaggtggtctttgtatacaaaaaatagcaaatactttgtaacaacatagttgatttttagtttta |
28887879 |
T |
|
| Q |
201 |
tgaaatttgttttcaggtatgctgttgtgacaggagcaaataagggaattggttatggaatatgtaaga |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28887880 |
tgaaatttgttttcaggtatgctgttgtgacaggagcaaataagggaattggttatggaatatgtaaga |
28887948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 269
Target Start/End: Original strand, 11925873 - 11925927
Alignment:
| Q |
215 |
aggtatgctgttgtgacaggagcaaataagggaattggttatggaatatgtaaga |
269 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
11925873 |
aggtatgcacttgtaacaggagctaataagggaattggttatggaatatgcaaga |
11925927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 269
Target Start/End: Complemental strand, 11945836 - 11945782
Alignment:
| Q |
215 |
aggtatgctgttgtgacaggagcaaataagggaattggttatggaatatgtaaga |
269 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||||||||||| ||||| |||| |
|
|
| T |
11945836 |
aggtatgcacttgtaacaggagctaataagggaattggttatgggatatgcaaga |
11945782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University