View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_57 (Length: 259)
Name: NF17287_high_57
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 255
Target Start/End: Original strand, 53785121 - 53785368
Alignment:
| Q |
8 |
ataatactacatcgaggggcgtacttaaagttgcactttcaaatgacgatggtgactcttggtatgaggctctcacattggaggattcttctggaatgga |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53785121 |
ataatactacatcgaggggcatacttaaagttgcactttctaatgatgatggtgattcttggtatgaggctctcacattggaggattcttctggaatgga |
53785220 |
T |
 |
| Q |
108 |
attctcttatcctgctgttatccaagctagtgatgggctaatacatatcacctatacatataaaaggacacaaattaaggtacacgcttaaaatttatgt |
207 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53785221 |
attctcctatcctgctgttatccaagctagtgatgggctaatacatatcacctatacatataaaaggacacaaattaaggtacacacttaaaatttatgt |
53785320 |
T |
 |
| Q |
208 |
agtagctgtctttaaattgtaggtttcagtttgtagatagtggagtgt |
255 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
53785321 |
agtagctgtctttaaactgtaggtttcagtttggagatagttgagtgt |
53785368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 100 - 189
Target Start/End: Original strand, 53794279 - 53794368
Alignment:
| Q |
100 |
ggaatggaattctcttatcctgctgttatccaagctagtgatgggctaatacatatcacctatacatataaaaggacacaaattaaggta |
189 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| | | ||| |||||||||||||||| || || |||||||||||| |
|
|
| T |
53794279 |
ggaatggaattttcatatcctgctgttatccaagctagtgatgggagagtccatgtcacctatacatataatagaactcaaattaaggta |
53794368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University