View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_68 (Length: 237)
Name: NF17287_high_68
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_68 |
 |  |
|
| [»] scaffold0790 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0790 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0790
Description:
Target: scaffold0790; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 39 - 153
Target Start/End: Original strand, 235 - 349
Alignment:
| Q |
39 |
aagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactac |
138 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
235 |
aagatggtgggggtagcgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttatttcaaactcactctcacttccgattcaaaactac |
334 |
T |
 |
| Q |
139 |
ccttcaaagtgtatg |
153 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
335 |
ccttcaaagtgtatg |
349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 17 - 93
Target Start/End: Original strand, 32284957 - 32285033
Alignment:
| Q |
17 |
aaatatatgtcgaactggggcgaagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtg |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32284957 |
aaatatatgtcgaactggggcgaagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtg |
32285033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 60 - 153
Target Start/End: Original strand, 24428207 - 24428303
Alignment:
| Q |
60 |
gagtttttgttggtggtgaatatgtggaa---tggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactacccttcaaagtgtatg |
153 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24428207 |
gagttttagttggtggtgaatatggcgaacggtggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactacccttcaaagtgtatg |
24428303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 33986068 - 33985988
Alignment:
| Q |
36 |
gcgaagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtggaaaggtttctttcaaagtcact |
116 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33986068 |
gcgaagatggtggggatagcgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttctttcaaagtcact |
33985988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University