View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_72 (Length: 230)
Name: NF17287_high_72
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_72 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 52807340 - 52807125
Alignment:
| Q |
1 |
gaaagcagtgaggcatagttattgttatttctaaagcctgtttactagagctctttcattctctctcactcattgaaactctttaagctagttccacgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807340 |
gaaagcagtgaggcatagttattgttatttctaaagcctgtttactagagctctttcattctctctcactcattgaaactctttaagctagttccacgtt |
52807241 |
T |
|
| Q |
101 |
tctttgatagaaaaacaaaagagagtaactaaactaaactagcttccaaagacaaagagggaagtgtatagggggtgtgtatatatcaagtgatgcgctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807240 |
tctttgatagaaaaacaaaagagagtaactaaactaaactagcttccaaagacaaagagggaagtgtatagggggtgtgtatatatcaagtgatgcgctc |
52807141 |
T |
|
| Q |
201 |
aggaggttgtgcattg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
52807140 |
aggaggttgtgcattg |
52807125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University