View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_73 (Length: 230)
Name: NF17287_high_73
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 33359819 - 33360029
Alignment:
| Q |
1 |
ctttgtggtgtctgtatttaacttcttaattatagaactcaattatcatccaagggacactcaaaattaaaaagaggataaggttannnnnnnnnnnnnn |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33359819 |
ctttgtggtgtgtgtatttaacttcttaattatagaactcaattatcatccaagggacactcaaaattaaaaagaggataaggttagtctctct------ |
33359912 |
T |
|
| Q |
101 |
nnnnnnatttatatgtgatgtgatattttcttcaaaaatacaaaatacaaaacaacaatgacttctcgtgtgagtgctgctcctacatgcgactgtgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33359913 |
------atttatatgtgatgtgatattttcttcaaaaatacaaaatacaaaacaacaatgacttctcgtgtgagtgctgctcctacatgcgactgtgaag |
33360006 |
T |
|
| Q |
201 |
caaagtgtatcatattcatctca |
223 |
Q |
| |
|
|||||||| ||||||| |||||| |
|
|
| T |
33360007 |
caaagtgtgtcatatttatctca |
33360029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University