View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_high_77 (Length: 201)
Name: NF17287_high_77
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_high_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 15 - 165
Target Start/End: Complemental strand, 55371945 - 55371795
Alignment:
| Q |
15 |
aaataataaatccaattaaattaattcaaaaccatccaaaagttgttactcaatggtgtaataaccgtcttcctaccaacactatgttagtacgactgaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
55371945 |
aaataataaatccaattaaattaattcaaaaccatctaaaagttgttactcaatggtgcaataatcgtcttcctaccaacactatgttagtacgactgaa |
55371846 |
T |
 |
| Q |
115 |
actagacttagatccctttagcaagttctgaggtttgaactttgtcgatgg |
165 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
55371845 |
actagacttagatcccttaagcaagttctgaggttcgaactttgtcgatgg |
55371795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University