View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_low_27 (Length: 416)
Name: NF17287_low_27
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 14641265 - 14641475
Alignment:
| Q |
1 |
agcgaaagcgaagtgaaaatctttggaatccgttttgaactcactcgccgtcattcttccactcttcactgatcggtttcatcaatctccaccgcttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14641265 |
agcgaaagcgaagtgaaaatctttggaatccgttttgaactcactcgccgtcattcttccactcttcactgatcggtttcatcaatctccaccgcttcac |
14641364 |
T |
 |
| Q |
101 |
caccagattctgtggtgctttcaacccataatttttcaannnnnnnncttaattcaattcaagtaaagtaatgatttttattctggtttattctcctatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14641365 |
caccagattctgtggtgctttcaacccataatttttcaattttttttcttaattcaattcaagtaaagtaatgatttttattctggtttattctcctatc |
14641464 |
T |
 |
| Q |
201 |
gcatgatcacc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
14641465 |
gcatgatcacc |
14641475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 357 - 399
Target Start/End: Original strand, 14641623 - 14641665
Alignment:
| Q |
357 |
ttgaagttatgctggacttcagagaaggttccaatgtgaaaag |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14641623 |
ttgaagttatgctggacttcagagaaggttccaatgtgaaaag |
14641665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University