View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_low_53 (Length: 292)
Name: NF17287_low_53
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 30781952 - 30782124
Alignment:
| Q |
12 |
tgaagacttggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaaccgtcccttttcttgcaaccattggtacaataagcgatgttcaa |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30781952 |
tgaagactaggaattaggtctttgctgatgataggaatgattcaaagcaaagtaaacggtcccttctcttgcaaccattggtacaataagcgatgttcaa |
30782051 |
T |
 |
| Q |
112 |
agagagaactttctttgttgttgcttgatcttcttactaggttatgcttcttcatagttctatcttgttattg |
184 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30782052 |
agagagaattttctttgttgttgcttgatcttcttactaggttatgcttcttcattgttctatcttgttattg |
30782124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 215 - 276
Target Start/End: Original strand, 30782240 - 30782301
Alignment:
| Q |
215 |
gtcgggtctcctttcatgggcctttgtaacacggaattgttgcaactgactccgttcaagaa |
276 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30782240 |
gtcgggtctcctttcatgggaatttgtaacacggaattgttgcaaccgactccgttcaagaa |
30782301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University