View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_low_60 (Length: 270)
Name: NF17287_low_60
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_low_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 20 - 214
Target Start/End: Complemental strand, 6103385 - 6103180
Alignment:
| Q |
20 |
gagttattagttattacagtgttggagatgaaacaaataaggagtaatttt-agtttagggattttgatgtctgatgtaat-taataa----gcaattgt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |||||| |||||||| |
|
|
| T |
6103385 |
gagttattagttattacagtgttggagatgaaacaaataaggagtaatttttagtttagggaatttgatgtctgatgtaatataataaatatgcaattgt |
6103286 |
T |
 |
| Q |
114 |
tatgttagaattgagtgaaatgattgagtagtctctctgaattgttcttgattga-----atcaagggtgaaaaatacgtgtaggttttgttttaatatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6103285 |
tatgttagaattgagtgaaatgattgagtagtctctttgaattgttcttgattgaaagtgatcaagggtgaaaaatatgtgtaggttttgttttaatatg |
6103186 |
T |
 |
| Q |
209 |
ttgatg |
214 |
Q |
| |
|
|||||| |
|
|
| T |
6103185 |
ttgatg |
6103180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University