View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_low_71 (Length: 248)
Name: NF17287_low_71
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 62 - 237
Target Start/End: Complemental strand, 42334804 - 42334629
Alignment:
| Q |
62 |
ctgttagttaattagttatatttgacgttgtgtctgtctttattttgttcattattcaatcacaacaagcttcttctttttctacgataaattacaacat |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334804 |
ctgttagttaattagttatatttgacgttgtgtctgtctttattttgttcattattcaatcacaacaagcttcttctttttctacgataaattacaacat |
42334705 |
T |
 |
| Q |
162 |
gcttatgcttagcttgtgatactttcatgtctttatttccttttttagttttaaggtaacagtcttgatttttcat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42334704 |
gcttatgcttagcttgtgatactttcatatctttatttccttttttagttttaaggtaacagtcttgatttttcat |
42334629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 42334870 - 42334819
Alignment:
| Q |
17 |
atatccacattctatcttgagggaggtggtgttacaacttgttagctgttagtta |
71 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42334870 |
atatccacattctatcttgagggaggtg---ttacaacttgttagctgttagtta |
42334819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University