View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17287_low_76 (Length: 237)

Name: NF17287_low_76
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17287_low_76
NF17287_low_76
[»] scaffold0790 (1 HSPs)
scaffold0790 (39-153)||(235-349)
[»] chr2 (1 HSPs)
chr2 (17-93)||(32284957-32285033)
[»] chr5 (1 HSPs)
chr5 (60-153)||(24428207-24428303)
[»] chr6 (1 HSPs)
chr6 (36-116)||(33985988-33986068)


Alignment Details
Target: scaffold0790 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: scaffold0790
Description:

Target: scaffold0790; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 39 - 153
Target Start/End: Original strand, 235 - 349
Alignment:
39 aagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactac 138  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||||||||||||| |||||||||    
235 aagatggtgggggtagcgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttatttcaaactcactctcacttccgattcaaaactac 334  T
139 ccttcaaagtgtatg 153  Q
    |||||||||||||||    
335 ccttcaaagtgtatg 349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 17 - 93
Target Start/End: Original strand, 32284957 - 32285033
Alignment:
17 aaatatatgtcgaactggggcgaagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtg 93  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32284957 aaatatatgtcgaactggggcgaagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtg 32285033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 60 - 153
Target Start/End: Original strand, 24428207 - 24428303
Alignment:
60 gagtttttgttggtggtgaatatgtggaa---tggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactacccttcaaagtgtatg 153  Q
    ||||||| ||||||||||||||||  |||   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24428207 gagttttagttggtggtgaatatggcgaacggtggtggaaaggtttctttcaaagtcactctcacttccgatccaaaactacccttcaaagtgtatg 24428303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 33986068 - 33985988
Alignment:
36 gcgaagatggtgggggtatcgtgagagtttttgttggtggtgaatatgtggaatggtggaaaggtttctttcaaagtcact 116  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
33986068 gcgaagatggtggggatagcgtgagagtttttgttggtggtgaatatgtggaacggtggaaaggtttctttcaaagtcact 33985988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University