View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_low_78 (Length: 237)
Name: NF17287_low_78
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_low_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 127 - 231
Target Start/End: Original strand, 1706016 - 1706120
Alignment:
| Q |
127 |
tatttatccccacatctgcatatgtccccacctcaattgaaagtccttggggctctctgaataaaaggagaaaaatgatatattttgtatatttacccat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1706016 |
tatttatccccacatctgcatatgtccccacctcaattgaaagtccttggggctctcggaataaaaggagaaaaatgatatattttgtatatttacccat |
1706115 |
T |
 |
| Q |
227 |
taacg |
231 |
Q |
| |
|
||||| |
|
|
| T |
1706116 |
taacg |
1706120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University