View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_low_80 (Length: 236)
Name: NF17287_low_80
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_low_80 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 100 - 222
Target Start/End: Original strand, 5395610 - 5395732
Alignment:
| Q |
100 |
tgctgcttcagtgattgagcggcgagtggtgaggtgttcaacaagaattgctcgaacgatgaatcttagtggcattatggggttttgaacacattcgact |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5395610 |
tgctgcttcggtgattgagcggcgagtggtgaggtgttcaacaagaattgctcgaacgatgaatcttagtggcattatggggttttgaacacattcgact |
5395709 |
T |
|
| Q |
200 |
agggtacgaggtgagagcttagt |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5395710 |
agggtacgaggtgagagcttagt |
5395732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 5395502 - 5395583
Alignment:
| Q |
1 |
attttggcggagagtggtgtcgagttggagaaattctctaagtgaggttcgttgtacttctacattttgtcgagcattagtg |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5395502 |
attttggcggagagtggtgtcgagttggagaaattctctaagtgaggttcgttgtacttctacatgttgtcgagcattagtg |
5395583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University