View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17287_low_86 (Length: 211)
Name: NF17287_low_86
Description: NF17287
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17287_low_86 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 24809257 - 24809145
Alignment:
| Q |
1 |
atgtatgtgtttcagagtttatattatgttttcatgtatacatataattacatgttcatttactcatgtaagggttttatacttgtattgtataatgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24809257 |
atgtatgtgtttcagagtttatattatgttttcatgtatacatataattacatgttcatttactcatgtaagggttttatacttgtattgtataatgtat |
24809158 |
T |
|
| Q |
101 |
agtatagtataat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24809157 |
agtatagtataat |
24809145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University