View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_high_30 (Length: 388)
Name: NF17288_high_30
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 26 - 316
Target Start/End: Complemental strand, 15570 - 15275
Alignment:
| Q |
26 |
aaggaaggaaggaagtatctaacgttgagattccagatttgccatgtgcatcataagcttgcctttgagttgggtcactgagaacttggtaagcttcgcc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
15570 |
aaggaaggaaggaagtatctaacgttgagattccagatttgccatgtgcatcataagcttgcctttgagttgggtcgctgagaacttggtaagcttcccc |
15471 |
T |
 |
| Q |
126 |
taaaacctaaaacaaagcaaagca-----gtggtagatagatgggtcaaacaaaacaaggccttgagaatagtataagaaaaagatagatagattgattg |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15470 |
taaaacctaaaacaaagcaaagcaaagcagtggtagatagatgggtcaaacaaaacaaggccttgagaatagtataagaaaaagatagatagattgattg |
15371 |
T |
 |
| Q |
221 |
attgactgacctgaaaattttgggcagcaagagggtcatttgggtttttatccggatgcacttgccttgcctgttaaataaataattggacagatc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
15370 |
attgactgacctgaaaattttgggcagcaagagggtcatttgggtttttatccggatgcacttgtcttgcctgttaaataaataattgaacagatc |
15275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 344 - 374
Target Start/End: Complemental strand, 15244 - 15214
Alignment:
| Q |
344 |
atataacacaaactggtgggtgggtggatct |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15244 |
atataacacaaactggtgggtgggtggatct |
15214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University