View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_high_34 (Length: 372)
Name: NF17288_high_34
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 60 - 342
Target Start/End: Original strand, 39678461 - 39678743
Alignment:
| Q |
60 |
caaatagggatttgattcgatttctgcagcacaccgtggttatctgaaggtcctctatacaccttgagaataaatcagttcatgatcaaaaaagcaaacc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678461 |
caaatagggatttgattcgatttctgcagcacaccgtggttatctgaaggtcctctatacaccttgagaataaatcagttcatgatcaaaaaagcaaacc |
39678560 |
T |
 |
| Q |
160 |
agtgcatcaaatacagaaagtgcatgcttagtttatttttctatataaggaattttgcagggacgctaagagcccagaatatcatattatgagtttcttg |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678561 |
agtgcatcgaatacagaaagtgcatgcttagtttatttttctatataaggaattttgcagggacgctaagagcccagaatatcatattatgagtttcttg |
39678660 |
T |
 |
| Q |
260 |
tctacgaggattcagtaataaaaaagtttatgaaagggtgtcattagtgactgtaatgtgcattttgtcctgttttttgaatt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678661 |
tctacgaggattcagtaataaaaaagtttatgaaagggtgtcattagtgactgtaatgtgcattttgtcctgttttttgaatt |
39678743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University