View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_high_39 (Length: 348)
Name: NF17288_high_39
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_high_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 18 - 337
Target Start/End: Complemental strand, 42190195 - 42189880
Alignment:
| Q |
18 |
ttaaatgttacttgtatcatatttcgaatttggagtagcactgttatacctctttttaggcttaaactaaatgtgcattggaacctgaggggaaattatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42190195 |
ttaaatgttacttgtatcatatttcgaatttggagtagcactgttatacctctttttaggcttaaactaaatatgcattggaacctgaggggaaattatg |
42190096 |
T |
|
| Q |
118 |
agttctattgctgcttatattggttcctccacttgcatccaagtttaatttcacctgttgggattgatggtgaagtataatttctacatcagatttgaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42190095 |
agttctattgctgcttatattggttcttccacttgcatccaagtttaatttcacctattgggattgatgatgaagtataatttctacatcagatttgaga |
42189996 |
T |
|
| Q |
218 |
tttaactatttaagccaaaatttaactaaatcgacagattcagattggaccgataatctatgtatgtacgtacctggtgtgtgaaaggaccattaatttg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42189995 |
tttaactatttaagccaaaatttaactaaatcgacagattcagattggaccgataatctatgtatgtacgtacctggtgtgtgaaaggacc----atttg |
42189900 |
T |
|
| Q |
318 |
gagtatgaaggacaaccttt |
337 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42189899 |
gagtatgaaggacaaccttt |
42189880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 253 - 338
Target Start/End: Original strand, 19533328 - 19533409
Alignment:
| Q |
253 |
agattcagattggaccgataatctatgtatgtacgtacctggtgtgtgaaaggaccattaatttggagtatgaaggacaacctttg |
338 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||| |||||||||||||| |||||||||| ||||||| ||||||| |
|
|
| T |
19533328 |
agattcagattggatcgataatttatgtatgtacgtacctgttgtgtgaaaggacc----atttggagtacgaaggacgacctttg |
19533409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University