View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_high_57 (Length: 276)
Name: NF17288_high_57
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 32 - 273
Target Start/End: Original strand, 2079677 - 2079919
Alignment:
| Q |
32 |
tatacctaaaattttaaggttttggattatgttctg-tgtccaactcattgctcttgatctaatatagattagacaatcgtccaaaaaccgataccagag |
130 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||| |||||||| |||||| |||||||||||||||||||||||||||||| | || ||||| |
|
|
| T |
2079677 |
tatatctaaaattttaaggttttggattatgttctggtgtcctactcattgttcttgacctaatatagattagacaatcgtccaaaaactggtatcagag |
2079776 |
T |
|
| Q |
131 |
acgtggttttgcttaatgagaacataatcctaatgtgtatgaagctagtcatatgtaggtgacctatacctgagagagtgattgttgaaaatctagtcat |
230 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2079777 |
atgtggttttgcttaatgagaacataatcctaatgtgtatgaagctagtcatatgtaggtgacctacacctgagagagtgattgttgaaaatctagtcat |
2079876 |
T |
|
| Q |
231 |
acgtaggtgacctacacacctacacctgagagagtgattgttg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2079877 |
acgtaggtgacctacacacctacacctgagagagtgattgttg |
2079919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 248 - 276
Target Start/End: Original strand, 2079838 - 2079866
Alignment:
| Q |
248 |
acctacacctgagagagtgattgttgaaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2079838 |
acctacacctgagagagtgattgttgaaa |
2079866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University