View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17288_high_60 (Length: 269)

Name: NF17288_high_60
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17288_high_60
NF17288_high_60
[»] chr1 (1 HSPs)
chr1 (19-259)||(29527942-29528181)


Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 29527942 - 29528181
Alignment:
19 ataacactcaacccaattagagtttctatgtccaatactcaataccgacgtcacgnnnnnnnnnactagaataactttagagaaaaattcttagccacaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||    
29527942 ataacactcaacccaattagagtttctatgtccaatactcaataccgacgtcacgttttttt--actagaataactttagagaaaaattcttagccacaa 29528039  T
119 gatgaatgtttggtataagagtcattcttaatttaatttgctgctccacacatatggaagaaatg-cagtttttgttcttttaaccaatttcaggtaaat 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
29528040 gatgaatgtttggtataagagtcattcttaatttaatttgctgctccacacatatggaagaaatgccagtttttgttcttttaaccaatttcaggtaaat 29528139  T
218 aattaagcttcactaatatatttagacggaacattatctctg 259  Q
    ||||||||||||||||||||||||||||||||||||||||||    
29528140 aattaagcttcactaatatatttagacggaacattatctctg 29528181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University