View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_high_64 (Length: 252)
Name: NF17288_high_64
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_high_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 12427335 - 12427096
Alignment:
| Q |
1 |
tcgacagaaaacaaagagtattttcttttttagaagttctttgagtctttatccgatgccttttattagagattatcttacaatggactattgagtttat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
12427335 |
tcgacagaaaacaaagagtattttcttttctataagttctttgagtctttatccgatgccttttttcagagatcatcttacaatggactattgagtttat |
12427236 |
T |
 |
| Q |
101 |
cgctaattggagacatttttcatagtaaaaagaaaagaattgaggtcgaaagcctatacttgaactgtctatctattgggttgaccctaactctgaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
12427235 |
cgctaattggagacatttttcatagtaaaaagaaaagaattgaggtctaaagcctttacttgaactgtctatctattgggttgacccta--tttgaaaca |
12427138 |
T |
 |
| Q |
201 |
cttgttcgcannnnnnnagactgtttcttttcctaccctatg |
242 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| |
|
|
| T |
12427137 |
cttgttcgcatttttttagactgtttcttttcctaccttatg |
12427096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University