View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_high_73 (Length: 234)
Name: NF17288_high_73
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_high_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 41085917 - 41085711
Alignment:
| Q |
11 |
tccaagaatattaacaatttgtcatcgacaccggaaagcgttgaaacggagaatgatgcagtggtccagcctcataaaccttttgatgaggttcagaatt |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41085917 |
tccaacaatattaacaatttgtcatcgacaccggaaagcgttgaaacggagaatgatgcagtggtccagcctcataaaccttttgatgaggttcagaatt |
41085818 |
T |
|
| Q |
111 |
atggaggtgaacatgagttgagtttgagtgggattgaatatgatcagtttgaagggtttctaggtgttgatgaagatgtggtacaagatgttctatggcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41085817 |
atggaggtgaacatgagttgagtttgagtgggattgaatatgatcagtttgaagggtttctaggtgttgatgaagatgtggtacaagatgttctatggcc |
41085718 |
T |
|
| Q |
211 |
tgattct |
217 |
Q |
| |
|
||||||| |
|
|
| T |
41085717 |
tgattct |
41085711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University