View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17288_high_78 (Length: 209)

Name: NF17288_high_78
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17288_high_78
NF17288_high_78
[»] chr3 (2 HSPs)
chr3 (16-195)||(50369013-50369192)
chr3 (39-192)||(50379179-50379332)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 195
Target Start/End: Complemental strand, 50369192 - 50369013
Alignment:
16 aaagggcatgaaggtaaattcgtaattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgg 115  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
50369192 aaagggcatgaaggtaaattcgtaattggtggtgattttccaacttttgctagctttggtaaggcttatgtatacggaacacccgttttggagtatccgg 50369093  T
116 gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaat 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50369092 gtttgattaaagccgcggtccatggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatgaat 50369013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 39 - 192
Target Start/End: Complemental strand, 50379332 - 50379179
Alignment:
39 aattggtggcgattttccaacttttgctagctttggtaaggtttatgtatacggaacacccgttttggagtatccgggtttgattaaagccgcggtccat 138  Q
    ||||||||| ||||||||||| ||||||||||| |||| |||||   | || ||| | ||   ||| |||| ||| ||||||||||| |  || || ||     
50379332 aattggtggtgattttccaacgtttgctagcttgggtagggttttattgtatggatcgccaagttttgagtttccaggtttgattaaggtggcagttcac 50379233  T
139 ggtggtcggttgtgtgacccggataagagaccgtggggctcagttgtgatgatg 192  Q
    ||||||    ||||||||||||||||||||||||||||  ||| ||||||||||    
50379232 ggtggtaacctgtgtgacccggataagagaccgtggggggcaggtgtgatgatg 50379179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University