View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_high_82 (Length: 205)
Name: NF17288_high_82
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_high_82 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 6297808 - 6298002
Alignment:
| Q |
1 |
gtctcatcgatgattcgaaaattagtctcataacaccctctcgaagggtttatgttgtcgggataactacgtacaatttgtcaattgatatctcatttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6297808 |
gtctcatcgatgattcgaaaattagtctcataacacactctctaagggtctatgttgtcgggataactacgtacaatttgtcaattgatgtctcatttag |
6297907 |
T |
|
| Q |
101 |
ctcttcaaatgtaaaaagccggggaattggatatggtgtggcgtgtgttcaaacttgtaatacatttctttgcgtttttgagttaagtttctctg |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6297908 |
ctcttcaagtgtaaaaagccggggaattggatatgttgtggcgcgtgttcaaacttgtaatacatttctttgtgtttttgagttaagtttctctg |
6298002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 130 - 170
Target Start/End: Original strand, 25462328 - 25462368
Alignment:
| Q |
130 |
gatatggtgtggcgtgtgttcaaacttgtaatacatttctt |
170 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||| |||| |
|
|
| T |
25462328 |
gatatgttgtggcgtgtgtttaaacttgtaatacatatctt |
25462368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University