View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_60 (Length: 269)
Name: NF17288_low_60
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 29527942 - 29528181
Alignment:
| Q |
19 |
ataacactcaacccaattagagtttctatgtccaatactcaataccgacgtcacgnnnnnnnnnactagaataactttagagaaaaattcttagccacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29527942 |
ataacactcaacccaattagagtttctatgtccaatactcaataccgacgtcacgttttttt--actagaataactttagagaaaaattcttagccacaa |
29528039 |
T |
 |
| Q |
119 |
gatgaatgtttggtataagagtcattcttaatttaatttgctgctccacacatatggaagaaatg-cagtttttgttcttttaaccaatttcaggtaaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29528040 |
gatgaatgtttggtataagagtcattcttaatttaatttgctgctccacacatatggaagaaatgccagtttttgttcttttaaccaatttcaggtaaat |
29528139 |
T |
 |
| Q |
218 |
aattaagcttcactaatatatttagacggaacattatctctg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29528140 |
aattaagcttcactaatatatttagacggaacattatctctg |
29528181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University