View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17288_low_63 (Length: 253)
Name: NF17288_low_63
Description: NF17288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17288_low_63 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 39677105 - 39677341
Alignment:
| Q |
15 |
atgaatgttagattagaaactttgggcttttgtatatcgacagaggttcccaaatacaagtatacaactataaaattgtcc-aaattttggagagcacgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39677105 |
atgaatgttagattagaaactttgggcttttgtatatcgacagaggttcccaaacacaagtatacaactataaaattgtcccaaattttggagagcacgg |
39677204 |
T |
 |
| Q |
114 |
caggaataatacagtacaaatcaaggaggatcaaatcagggtctggataccatgttgaagttgtgggatgttagataaaaggatgaannnnnnnnagaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
39677205 |
caggaataatacagtacaaatcaaggaggatcaaatcagggtctggataccatgttgaagttgtgggatgttagttaaaaggatgaatatttttt---ag |
39677301 |
T |
 |
| Q |
214 |
aactataaatcttcttgataataacttgatacaaaagact |
253 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39677302 |
aactataaatcttcttcataataacttgatacaaaagact |
39677341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University